Chapter 4 Filtering Badly Aligned Reads
Once we have an alignment, the next step is often to throw out the reads that align badly or not in pairs as we we expect. To do this we need to look at the alignments and assess them one-by-one. We’ll need first to have some understanding of the output from our alignment, in this case aln.sam a SAM format file.
4.1 SAM Format
Alignments are generally stored in SAM format, a standard for describing how each read aligned one-by-one. Each line carries the results for a single read. Let’s examine a single reads alignment. Recall that we can look at one line in a file called aln.sam using tail -n 1 aln.sam (this gives the bottom line in the file). Running this prints the following
NC_011750.1_1004492_1005000_1:0:0_3:0:0_1869f 147 NC_011750.1 1004931 33 70M = 1004492 -509 TTATATTATTTGGGTTCCTGTGCTGGCGGCTATCTGGAGTATTGGCAGCCTGACAAGCAATGCCTACAAA 2222222222222222222222222222222222222222222222222222222222222222222222 NM:i:3 ms:i:110 AS:i:110 nn:i:0 tp:A:P cm:i:2 s1:i:59 s2:i:0 de:f:0.0429 rl:i:0
On close inspection we can see this mess (which is only a single line) contains things like the read name, the position it maps to on the reference sequence, the read sequence, and lots of other strange things like 70M and de:f:0.0429. The important thing to note is that these weird things are encoded quality information for this alignment, so we can - if we know how to manipulate those codes - select read alignment of the proper quality.
Thankfully the program samtools makes this easy for us.
4.2 samtools
We can accomplish read filtering with the following command.
samtools view -S -h -q 25 -f 3 aln.sam > aln.filtered.sam
Try running that and looking at the output file that is generated. You should have another SAM format file called aln.filtered.sam in your working directory.
Let’s take a look at that command in detail
4.3 The samtools command and options
Straight away, the command seems to fit the familiar program name options files pattern. It starts with
samtools
which is the program name. Then we get the options
view -S -h -q 25 -f 3
The first option to samtools must be the name of the sub-program to run. There are lots of these as samtools is a suite of sub-programs. view is the option for working with alignments directly. The second option -S tells samtools view that we are handing it a SAM format file (soon we will hand it a different type) and -h tells it to show the header as well (each SAM file has a header that we sometimes don’t want). The next two options are the important ones. -q 25 will remove reads with a mapping quality (a measure of how well a read is aligned) lower than 25 (a reasonable score) and -f 3 is a ‘flag’ a really complex way of encoding alignment attributes (see Further Reading for more details). The important thing is that 3 means keep reads that are paired and whose pair is mapped too.
At the end of the command is the input and output file information
aln.sam > aln.filtered.sam
which means the input file is our aln.sam and that the output should be redirected to aln.filtered.sam
4.4 Checking the filtering
As an exercise to show that we did filter stuff out lets compare the input aln.sam file with the output aln.filtered.sam file. Recall that wc -l will give us the number of lines in a text file. Run it like this, on both files at once
wc -l aln.sam aln.filtered.sam
I get this as output
200002 aln.sam
166905 aln.filtered.sam
366907 total
The number of lines (alignments) in the filtered files is less than that in the unfiltered, so we can casually assume the command worked.
And that’s all there is to getting the reads filtered. In real-life you have many options for filtering and you may choose to do it at other points (for instance, lots of RNAseq quantification programs will allow you to filter when you use them), but the process will be similar and take advantage of the same mapping quality and flag metrics you’ve been introduced to here.
4.5 Are we done?
On the face of it then, it looks like we’ve come to the end of what we intended to do - we did an alignment, and we’ve filtered out the poor ones. In practice though, we’ll be dealing with many millions of reads, many files of many Gb size. This complicates the housekeeping we have to do, not the procedure we’ve learned per se, so before we jump to the HPC we need to look at that. That’s the next chapter.
4.6 Further Reading
4.6.1 SAM Format
I only really alluded to the SAM format above, but there’s a lot to it. This Wikipedia page gives a lot of detail.
4.6.2 Mapping Quality
A metric that describes how well overall the read aligned, it takes into account not just the alignment, but the nubmer of other possible alignments that were rejected. Consider that a read mapping well equally at a number of places in the genome cannot be said to be mapping well at all. Different aligners make arbitrary decisions about how to score such alignments. See this short summary for information on how it can be calculated.
4.6.3 Flags
The flags option is the most powerful way to describe a filter to samtools view, it is also really complicated. The number you pass (e.g -f 3) is calculated as a sum of lots of options. The way they’re are described in the documentation is a bit more complex than I want to go into, but there are helpful web-apps that can simplify things - try this one